View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14607_low_28 (Length: 259)

Name: NF14607_low_28
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14607_low_28
NF14607_low_28
[»] chr6 (1 HSPs)
chr6 (1-251)||(13726161-13726411)


Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 13726411 - 13726161
Alignment:
Q  1 ccaaaatggagtaaaaatcacactagtgaacaccatttccatttggaacaaaatcaacaacaacattgatctaaattcaattcaaactgaaagcatttca 100  Q
    |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||    
T  13726411 ccaaaaaggagtaaaaataacactagtgaacaccatttccatttggaacaaaatcaacaacaacattgatctcaattcaattgaaactgaaagcatttca 13726312  T
Q  101 gatggttatgacaatggaggaatgtcatcagcagaaaatatggaatcttacaaagacactttctggaaagttggaccaaaatcactttctcagcttcttc 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13726311 gatggttatgacaatggaggaatgtcatcagcagaaaacatggaatcttacaaagacactttctggaaagttggaccaaaatcactttctcagcttcttc 13726212  T
Q  201 ataaacttcaaagttcaaacaaccctgttgattgtgttgtctgtgctgctt 251  Q
    |||||||||||||||||||||||||||||||||||||||||| || |||||    
T  13726211 ataaacttcaaagttcaaacaaccctgttgattgtgttgtctatgatgctt 13726161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University