View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14602_high_11 (Length: 243)

Name: NF14602_high_11
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14602_high_11
NF14602_high_11
[»] chr4 (1 HSPs)
chr4 (14-193)||(27744591-27744765)
[»] chr3 (1 HSPs)
chr3 (20-52)||(49513434-49513466)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 27744591 - 27744765
Alignment:
Q  14 agcagcagagaatgaatcaaattctactacagacgaagaagaagatacatacacagatgaagatactgacacacttgatatgcaggtacttttatgccca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27744591 agcagcagagaatgaatcaaattctactacagacgaagaagaagatacatacacagatgaagatactgacacacttgatatgcaggtacttttatgccca 27744690  T
Q  114 aactgagatatttgcagggaccaagcacatgtttaannnnnnnnnnnncttccttcgttattagtgtttttgttgttatt 193  Q
    |||||||||| |||||||||||||||||||||||||             |||||||||||||||||||||||||||||||    
T  27744691 aactgagatacttgcagggaccaagcacatgtttaaattttttt-----ttccttcgttattagtgtttttgttgttatt 27744765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 49513434 - 49513466
Alignment:
Q  20 agagaatgaatcaaattctactacagacgaaga 52  Q
    ||||||||||||||||||||||||||| |||||    
T  49513434 agagaatgaatcaaattctactacagatgaaga 49513466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University