View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1459_low_142 (Length: 241)

Name: NF1459_low_142
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1459_low_142
NF1459_low_142
[»] chr2 (1 HSPs)
chr2 (3-148)||(5294063-5294208)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 3 - 148
Target Start/End: Complemental strand, 5294208 - 5294063
Alignment:
Q  3 tttaacttgactataccttgttttcttccacttttgttaccatattttccaccaatatcaaaacatgaaggttgagaaatcttcttttctttctgcataa 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  5294208 tttaacttgactataccttgttttcttccacttttgttaccatattttccaccaatatcaaaacatgaaggttgagaaatcttcttttctttctgcttaa 5294109  T
Q  103 tttttgcatgatttgaatctgaattgattctcatatgtttcaactt 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  5294108 tttttgcatgatttgaatctgaattgattctcatatgtttcaactt 5294063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University