View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14593_low_17 (Length: 276)

Name: NF14593_low_17
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14593_low_17
NF14593_low_17
[»] chr7 (2 HSPs)
chr7 (12-176)||(22082522-22082687)
chr7 (21-108)||(22065272-22065361)
[»] scaffold0867 (1 HSPs)
scaffold0867 (41-108)||(3994-4061)


Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 176
Target Start/End: Original strand, 22082522 - 22082687
Alignment:
Q  12 agtgagatgaacatatatgtgtggcaatgtggctatgattgtgttcttactcttgatgagtttatgctaattaggttgcctctatagcaagcttgattgt 111  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  22082522 agtgatatgaacatatatgtgtggcaatgtggctatgattgtgttcttactcttgatgagtttatgataattaggttgcctctatagcaagcttgattgt 22082621  T
Q  112 gtttcaatata-atgcatgttattataatcacattgaacgaaaaagtcatcagctgcaactcatat 176  Q
    ||||||||  |  |  ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22082622 gtttcaatgcatgttaatgttattataatcacattgaacgaaaaagtcatcagctgcaactcatat 22082687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 108
Target Start/End: Original strand, 22065272 - 22065361
Alignment:
Q  21 aacatatatgtgtggcaatgtggct--atgattgtgttcttactcttgatgagtttatgctaattaggttgcctctatagcaagcttgat 108  Q
    ||||||||| |||||||||||||||  |||||||  ||| ||||||| |||||||| ||||||| | ||||||||| | |||||||||||    
T  22065272 aacatatatatgtggcaatgtggctctatgattgcattcctactctttatgagtttttgctaataatgttgcctctttggcaagcttgat 22065361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0867 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0867
Description:

Target: scaffold0867; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 108
Target Start/End: Complemental strand, 4061 - 3994
Alignment:
Q  41 tggctatgattgtgttcttactcttgatgagtttatgctaattaggttgcctctatagcaagcttgat 108  Q
    |||||||||||||| || || |||| |||||||   |||||||||||||||||||| |||||||||||    
T  4061 tggctatgattgtgatcgtaatcttaatgagttatggctaattaggttgcctctatggcaagcttgat 3994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University