View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1458_high_35 (Length: 223)

Name: NF1458_high_35
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1458_high_35
NF1458_high_35
[»] chr1 (1 HSPs)
chr1 (7-210)||(27124855-27125058)
[»] chr7 (1 HSPs)
chr7 (10-201)||(41604248-41604439)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 210
Target Start/End: Complemental strand, 27125058 - 27124855
Alignment:
Q  7 attaataggttgaaccgtgaaccattgttcttggaattggacttgcaaaccctctacttcatcttgaagaaggagtgtgaggaatccatagtcagaatga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  27125058 attaataggttgaaccgtgaaccattgttcttggaattggacttgcaaaccctctacctcatcttgaagaaggagtgtgaggaatccatagtcagaatga 27124959  T
Q  107 gggggcatgcctagggttaggtcaggttgaggacatggaggataaaaatttgccgccataagctggcttccatcttccaattctttgataatattgtcct 206  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  27124958 gggggcatgcctagggttaggtcaggttgaggacatggtggataaaaatttgccgccataagctggcttccatcttccaattctttgataagattgtcct 27124859  T
Q  207 tttc 210  Q
    ||||    
T  27124858 tttc 27124855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 41604248 - 41604439
Alignment:
Q  10 aataggttgaaccgtgaaccattgttcttggaattggacttgcaaaccctctacttcatcttgaagaaggagtgtgaggaatccatagtcagaatgaggg 109  Q
    |||||||||||| |||| |||||  |||||  |||||| |||||||||||| ||||||||||| || || ||||||||||| ||||| ||||| ||||||    
T  41604248 aataggttgaacagtgagccatttgtcttgatattggatttgcaaaccctccacttcatcttggaggagaagtgtgaggaagccataatcagagtgaggg 41604347  T
Q  110 ggcatgcctagggttaggtcaggttgaggacatggaggataaaaatttgccgccataagctggcttccatcttccaattctttgataatatt 201  Q
     |||| || || |||||||| |||| ||| ||||| || |||||||| |   |||  | |||||| ||||  ||||||||||| ||||||||    
T  41604348 tgcattccaagtgttaggtctggttcagggcatggtgggtaaaaattggttaccaacatctggctcccattgtccaattctttcataatatt 41604439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University