View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14587_low_9 (Length: 311)

Name: NF14587_low_9
Description: NF14587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14587_low_9
NF14587_low_9
[»] chr3 (2 HSPs)
chr3 (172-295)||(32496998-32497122)
chr3 (72-102)||(32497199-32497229)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 172 - 295
Target Start/End: Complemental strand, 32497122 - 32496998
Alignment:
Q  172 gaaatttatgaaaacacaaacatagagtgaaaccaaaaccgcagcaaaaaa-catcatcatcttctacttctctccgtaacaacaacgttgttgcgtgac 270  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |    
T  32497122 gaaatttatgaaaacacaaacatagagtgaaaccaaaaccgcagcaaaaaaacatcatcatcttctacttctctccgtaacaacaacgttgttgcgtgtc 32497023  T
Q  271 gaacaacaatgaactccactacttt 295  Q
    |||||||||||||||||||||||||    
T  32497022 gaacaacaatgaactccactacttt 32496998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 102
Target Start/End: Complemental strand, 32497229 - 32497199
Alignment:
Q  72 gaccaaataattatccacaatcacttttgtc 102  Q
    |||||||||||||||||||||||||||||||    
T  32497229 gaccaaataattatccacaatcacttttgtc 32497199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University