View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14585_high_6 (Length: 350)

Name: NF14585_high_6
Description: NF14585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14585_high_6
NF14585_high_6
[»] chr4 (2 HSPs)
chr4 (187-342)||(25379147-25379302)
chr4 (15-120)||(25378975-25379080)
[»] chr8 (1 HSPs)
chr8 (191-254)||(38333982-38334045)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 187 - 342
Target Start/End: Original strand, 25379147 - 25379302
Alignment:
Q  187 aggatgctaatgagaggaaacaatctctaaggaagcgtaaaagatcatatgttgctggtgtggaggatgaccgtgataaaagctcaaggcagctgagaaa 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25379147 aggatgctaatgagaggaaacaatctctaaggaagcgtaaaagatcatatgttgctggtgtggaggatgaccgtgataaaagctcaaggcagctgagaaa 25379246  T
Q  287 acaagtagcttgtgaacatgttaaaaactcaaactcattgattgaggatgatgatg 342  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25379247 acaagtagcttgtgaacatgttaaaaactcaaactcattgattgaggatgatgatg 25379302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 15 - 120
Target Start/End: Original strand, 25378975 - 25379080
Alignment:
Q  15 agaagagtttacaaactccgtagatagtcctacattagctgattttttaccgcacgacgttaccagaggaaaagaagtagacattgattattatgatttg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  25378975 agaagagtttacaaactccgtagatagtcctacattagctgattttttaccgcacgacgttaccagaggaaaagaagtagacattaattattatgatttg 25379074  T
Q  115 tcttgc 120  Q
    ||||||    
T  25379075 tcttgc 25379080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 191 - 254
Target Start/End: Complemental strand, 38334045 - 38333982
Alignment:
Q  191 tgctaatgagaggaaacaatctctaaggaagcgtaaaagatcatatgttgctggtgtggaggat 254  Q
    |||||||||||| ||| ||||||||| ||||| ||||| ||| | | |||||||||||||||||    
T  38334045 tgctaatgagagaaaaaaatctctaaagaagcataaaatatcttctattgctggtgtggaggat 38333982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University