View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14579_low_30 (Length: 306)

Name: NF14579_low_30
Description: NF14579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14579_low_30
NF14579_low_30
[»] chr4 (1 HSPs)
chr4 (16-306)||(4021557-4021847)
[»] scaffold0376 (1 HSPs)
scaffold0376 (178-255)||(5113-5190)


Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 306
Target Start/End: Original strand, 4021557 - 4021847
Alignment:
Q  16 gaaggaggactcgaagtaaaaaacttgtacttatttcatttaacgttacgaagaaaatggttatggaggtgcattgcggaaaatggtactatttggttcg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  4021557 gaaggaggactcgaagtaaaaaacttgtacttatttcatttaaagttacgaagaaaatggttatggaggtgcattgcggaaaatggtactatttggttca 4021656  T
Q  116 ggttaataaagtataggtacagtccagtttcaggaaaattgctccgtccagataccgtgtagtcgggaaggatagactcgttatggcggcgatatttatg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4021657 ggttaataaagtataggtacagtccagtttcaggaaaattgctccatccagataccgtgtagtcgggaaggatagactcgttatggtggcgatatttatg 4021756  T
Q  216 ttctattggaaaggcatgtgaagtcgaaccaaactggtttacaaattaagttatgtgagtagtcggaaatggtgaaaagtgaaaacacatt 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||    
T  4021757 ttctattggaaaggcatgtgaagtcgaaccaaactggtttacaaattaagttaagtgagtagttggaaacggtgaaaagtgaaaacacatt 4021847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 178 - 255
Target Start/End: Original strand, 5113 - 5190
Alignment:
Q  178 tcgggaaggatagactcgttatggcggcgatatttatgttctattggaaaggcatgtgaagtcgaaccaaactggttt 255  Q
    ||||||||| |||||||||||||| ||||  |||||||||| || |||||||  |||||||| |||||||||||||||    
T  5113 tcgggaaggttagactcgttatggtggcgtgatttatgttcaataggaaaggtgtgtgaagtggaaccaaactggttt 5190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University