View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14577_low_14 (Length: 243)

Name: NF14577_low_14
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14577_low_14
NF14577_low_14
[»] chr3 (2 HSPs)
chr3 (131-243)||(38622875-38622988)
chr3 (96-139)||(38622825-38622868)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 131 - 243
Target Start/End: Original strand, 38622875 - 38622988
Alignment:
Q  131 ttttggtttggtaactcctcgtacccacc-actcccatcaggcttcttgtttattcccccactcacttacacgctgaaacaagtagtaacaacaaaacaa 229  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38622875 ttttggtttggtaactcctcgtacccacccactcccatcaggcttcttgtttattcccccactcacttacacgctgaaacaagtagtaacaacaaaacaa 38622974  T
Q  230 ctccattaataacc 243  Q
    ||||||||||||||    
T  38622975 ctccattaataacc 38622988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 139
Target Start/End: Original strand, 38622825 - 38622868
Alignment:
Q  96 ccattaattgtgacattattattaagttagattagttttggttt 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  38622825 ccattaattgtgacattattattaagttagattagttttggttt 38622868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University