View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14575_low_23 (Length: 241)

Name: NF14575_low_23
Description: NF14575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14575_low_23
NF14575_low_23
[»] chr7 (1 HSPs)
chr7 (11-223)||(47583495-47583707)


Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 47583495 - 47583707
Alignment:
Q  11 tcttcagatcatagttcaattgattaaatcatgatttttagtttcttattcagatgaattgatatgtagttgaatgtaaatgtgatgatgcaggtgacaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  47583495 tcttcagatcatagttcaattgattaaatcatgatttttagtttcttattccgatgaattgatatgtagttgaatgtaaatgtgatgatgcaggtgacaa 47583594  T
Q  111 attcagggacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggagggttggatttggatgtgggagtgtttaacagaatcgacacaga 210  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47583595 attcaggtacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggagggttggatttggatgtgggagtgtttaacagaatcgacacaga 47583694  T
Q  211 tggcagaggatac 223  Q
    |||||||||||||    
T  47583695 tggcagaggatac 47583707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University