View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14574_high_8 (Length: 204)

Name: NF14574_high_8
Description: NF14574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14574_high_8
NF14574_high_8
[»] chr4 (1 HSPs)
chr4 (15-186)||(22456096-22456267)
[»] chr6 (1 HSPs)
chr6 (125-173)||(33559637-33559685)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 22456267 - 22456096
Alignment:
Q  15 agaaaatctattttaaaaatgtgacaacatattgacaagaatagtgttaaagtcgtgagtactccattggtgaatcacttattaagctcttattgaggca 114  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22456267 agaaaatctattttgaaaatgtgacaacatattgacaagaataatgttaaagtcgtgagtactccattggtgaatcacttattaagctcttattgaggca 22456168  T
Q  115 gtgtttaaacatagattcacaagtttagtatatgtcaaaggttccttatttcaatgttacagactgtttaat 186  Q
    |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  22456167 gtgtttaaacatagatacaaaagtttagtatatgtcaaaggttccttatttcaatgttacagattgtttaat 22456096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 173
Target Start/End: Complemental strand, 33559685 - 33559637
Alignment:
Q  125 atagattcacaagtttagtatatgtcaaaggttccttatttcaatgtta 173  Q
    |||||| || ||||| ||||||||||||||||||||||| ||| |||||    
T  33559685 atagatgcagaagttaagtatatgtcaaaggttccttatgtcagtgtta 33559637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University