View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14574_high_5 (Length: 309)

Name: NF14574_high_5
Description: NF14574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14574_high_5
NF14574_high_5
[»] chr4 (1 HSPs)
chr4 (5-254)||(52794122-52794369)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 5 - 254
Target Start/End: Original strand, 52794122 - 52794369
Alignment:
Q  5 gagagatgaaatacgatttgtttttagaaacaannnnnnnatcggtatttatagaaatgatttgattttgttgatgaatcaaacgcgtggtaattaatgg 104  Q
    ||||||||||||||||||||||| |||||||||       |||||||||| |||||| ||||||||||||||||||||||||||||||||||||    ||    
T  52794122 gagagatgaaatacgatttgtttatagaaacaatttttttatcggtatttctagaaaggatttgattttgttgatgaatcaaacgcgtggtaata---gg 52794218  T
Q  105 cttacttgtacaataccattttatatgtggtactttactgattattgaatgatttgcttaaattagagatgcagtaccattc-nnnnnnnggaaatgaat 203  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||    
T  52794219 cttacttgtgcaataccattttatatgtggtactttactgattattgaatgatttgcttaaattagagatgcagtaccattctttttattggaaatgaat 52794318  T
Q  204 tgattttgttcataatacaaacgcgtccgattttgcattcactgcatacat 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52794319 tgattttgttcataatacaaacgcgtccgattttgcattcactgcatacat 52794369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University