View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14572_low_65 (Length: 240)

Name: NF14572_low_65
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14572_low_65
NF14572_low_65
[»] chr4 (1 HSPs)
chr4 (20-212)||(32040791-32040983)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 32040791 - 32040983
Alignment:
Q  20 taacccagatgatctaccttttactttggaaaatcacaaaggatacgatgcttctaaatatctttttcagcatcatcaaatattttatgatggtaactcg 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||    
T  32040791 taacccagatgatctaccttttactttggaaaatcacaaaggatacaatgcttttaaatatctttttcagcatcatcaaatattttatgatggtaattcg 32040890  T
Q  120 agggttaacctatgttcattcttatctcatccataaattttttcagagtttaggtcattcccagagtctattaattcatatgaattaactcga 212  Q
    ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| || ||||||||| |||||||||||||||||||||    
T  32040891 agggttaacctatgttcattcttatctcatccacaatttttttcagagtttaggtcataccgagagtctataaattcatatgaattaactcga 32040983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University