View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1456_low_28 (Length: 233)

Name: NF1456_low_28
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1456_low_28
NF1456_low_28
[»] scaffold0193 (1 HSPs)
scaffold0193 (14-141)||(23735-23862)


Alignment Details
Target: scaffold0193 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: scaffold0193
Description:

Target: scaffold0193; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 23735 - 23862
Alignment:
Q  14 agaagatatgaatatagtgaacaatggatcgtagtttaaagaatactagagatactctaaacctagtacaatctaatatttatttttgaaaaagggatca 113  Q
    |||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  23735 agaagatatgaatatagtgaacaatggatcatagtttaaagaaaactagagatactataaacctagtacaatctaatatttatttttgaaaaagggatca 23834  T
Q  114 cattagtttattatatttttaaattgtt 141  Q
    ||||||||||||||||||||||||||||    
T  23835 cattagtttattatatttttaaattgtt 23862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University