View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14564_low_14 (Length: 250)

Name: NF14564_low_14
Description: NF14564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14564_low_14
NF14564_low_14
[»] chr1 (2 HSPs)
chr1 (12-153)||(7884751-7884892)
chr1 (150-250)||(7885052-7885152)
[»] chr3 (1 HSPs)
chr3 (39-103)||(53033206-53033270)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 153
Target Start/End: Original strand, 7884751 - 7884892
Alignment:
Q  12 ataggggagagtgtaggtgaagttcgggctgtatcggacatgcaccaatgcaaggccgaaatggctcgacaagccgatgcttttattgccttgctaggtt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||    
T  7884751 ataggggagagtgtaggtgaagttcgggctgtatcggacatgcaccaacgcaaggccgaaatggctcgacaggccgatgcttttattgccttgccaggtt 7884850  T
Q  112 acttttttctcttcgtagctctaacatggtaactcaagaaaa 153  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  7884851 acttttttctcttcgtagctctaacatggtaactcaagaaaa 7884892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 150 - 250
Target Start/End: Original strand, 7885052 - 7885152
Alignment:
Q  150 aaaacgtacgttttatctcattgcagtttttataacaataattttcctattcttataggtggatatgacaccttggaagaactattagaagtgatcacct 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7885052 aaaacgtacgttttatctcattgcagtttttataacaataattttcctattcttataggtggatatgacaccttggaagaactattagaagtgatcacct 7885151  T
Q  250 c 250  Q
    |    
T  7885152 c 7885152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 103
Target Start/End: Original strand, 53033206 - 53033270
Alignment:
Q  39 gctgtatcggacatgcaccaatgcaaggccgaaatggctcgacaagccgatgcttttattgcctt 103  Q
    ||||||||||||||||||||| |||| |||||||||||||||||||| ||||| |||||||||||    
T  53033206 gctgtatcggacatgcaccaacgcaaagccgaaatggctcgacaagctgatgcatttattgcctt 53033270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University