View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1454_low_8 (Length: 255)

Name: NF1454_low_8
Description: NF1454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1454_low_8
NF1454_low_8
[»] chr1 (3 HSPs)
chr1 (1-146)||(26336057-26336202)
chr1 (23-97)||(26323062-26323136)
chr1 (1-57)||(26328346-26328402)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 26336057 - 26336202
Alignment:
Q  1 actctctcagatatcaccaattctattgcttatgtctctgttgctggaaatgactactatgattacatggccatagatggctctctttcggtaaattact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26336057 actctctcagatatcaccaattctattgcttatgtctctgttgctggaaatgactactatgattacatggccatagatggctctctttcggtaaattact 26336156  T
Q  101 taattttaatcatcatactttatatatttctatgatgtaaagtatg 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  26336157 taattttaatcatcatactttatatatttctatgatgtaaagtatg 26336202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 23 - 97
Target Start/End: Original strand, 26323062 - 26323136
Alignment:
Q  23 ctattgcttatgtctctgttgctggaaatgactactatgattacatggccatagatggctctctttcggtaaatt 97  Q
    |||||||||||||||| |||||||||||||||||| || ||||| |||||| | ||||||||||| |||||||||    
T  26323062 ctattgcttatgtctcagttgctggaaatgactacaatcattacttggccacaaatggctctcttccggtaaatt 26323136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 26328346 - 26328402
Alignment:
Q  1 actctctcagatatcaccaattctattgcttatgtctctgttgctggaaatgactac 57  Q
    |||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||    
T  26328346 actccctcagatatcaccaaatctatagcttatgtctctgttgctggaaatgactac 26328402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University