View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14546_high_30 (Length: 204)

Name: NF14546_high_30
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14546_high_30
NF14546_high_30
[»] chr1 (1 HSPs)
chr1 (82-189)||(15302351-15302462)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 82 - 189
Target Start/End: Complemental strand, 15302462 - 15302351
Alignment:
Q  82 gaaacaagcacagtcctaaat----atatatgacaaatatacaaaggattcactattgtgtttgatactatcgatactccatcgaaaaacttattagacg 177  Q
    |||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15302462 gaaacaagcacagtcctaaatgaatatatatgacaaatatacaaaggattcactattgtgtttgatactatcgatactccatcgaaaaacttattagacg 15302363  T
Q  178 cataagaagtat 189  Q
    ||||||||||||    
T  15302362 cataagaagtat 15302351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University