View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14537_low_17 (Length: 202)

Name: NF14537_low_17
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14537_low_17
NF14537_low_17
[»] chr5 (2 HSPs)
chr5 (20-190)||(30804684-30804854)
chr5 (104-145)||(30801101-30801142)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 30804684 - 30804854
Alignment:
Q  20 ggccagggtgaaataggtaatcttcaaatgtttcacaaattcatcttagtgaacaaatatgaataaaataacnnnnnnnagggaaaatatgaataaaata 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       |||||||||||||||||||||    
T  30804684 ggccagggtgaaataggtaatcttcaaatgtttcacaaattcatcgtagtgaacaaatatgaataaaataactttttttagggaaaatatgaataaaata 30804783  T
Q  120 attatttcattaaaagtattttaagatataaaaatttcaagtttattgtggggatgtgcaaaggtaaactt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30804784 attatttcattaaaagtattttaagatataaaaatttcaagtttattgtggggatgtgcaaaggtaaactt 30804854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 145
Target Start/End: Original strand, 30801101 - 30801142
Alignment:
Q  104 aaatatgaataaaataattatttcattaaaagtattttaaga 145  Q
    ||||||||||||||||||||||||| ||||||||||||||||    
T  30801101 aaatatgaataaaataattatttcagtaaaagtattttaaga 30801142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University