View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14536_low_18 (Length: 227)

Name: NF14536_low_18
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14536_low_18
NF14536_low_18
[»] chr3 (2 HSPs)
chr3 (123-222)||(12049445-12049544)
chr3 (1-41)||(12049626-12049666)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 222
Target Start/End: Complemental strand, 12049544 - 12049445
Alignment:
Q  123 agtcaacatttaaaatacattacccacaaagatacagcataaatcaattgtaaaaataataatttgtttttatatcaaaatgtt---atataaatagtat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||   |||||||||||||    
T  12049544 agtcaacatttaaaatacattacccacaaagatacagcataaatcaattgtaaaaa---taatttgtttttatatcaaaatgttaaaatataaatagtat 12049448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 12049666 - 12049626
Alignment:
Q  1 caacgatgtcgtcgctctcaccttccccaacaccatcgagg 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  12049666 caacgatgtcgtcgctctcaccttccccaacaccatcgagg 12049626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University