View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14526_high_10 (Length: 239)

Name: NF14526_high_10
Description: NF14526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14526_high_10
NF14526_high_10
[»] chr7 (2 HSPs)
chr7 (1-177)||(21916542-21916715)
chr7 (172-221)||(21916482-21916531)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 21916715 - 21916542
Alignment:
Q  1 ttagacattgattttaagctcactaagcatccttatgactttttctaaagttcagcaacactattaactgaagtgagattagtgtcataacttcctccga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21916715 ttagacattgattttaagctcactaagcatccttatgactttttctaaagttcagcaacactattaactgaagtgagattagtgtcataacttcctccga 21916616  T
Q  101 ttacgggaaaataagaaggcttctttaatgatcatgaaacaacaatataattatgaaaagttgaaccctagcatgca 177  Q
    ||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  21916615 ttacgggaaaat---aaggcttctttaatgatcatgaaacaacaatataattatgaaaagttgaaacctagcatgca 21916542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 21916531 - 21916482
Alignment:
Q  172 catgcaaaggaataaaagcagctgcatttgtcttttcttcatggttaagt 221  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||    
T  21916531 catgcaaaggaaaaaaagcagctgcatatgtcttttcttcatggttaagt 21916482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University