View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14507_low_22 (Length: 273)

Name: NF14507_low_22
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14507_low_22
NF14507_low_22
[»] chr1 (2 HSPs)
chr1 (21-94)||(39511510-39511583)
chr1 (24-92)||(39518295-39518363)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 39511510 - 39511583
Alignment:
Q  21 tgtacaatgaatacattgtttataatgtggaccagattaagatgcgttatgttgttaacgttaaattcaatttt 94  Q
    ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
T  39511510 tgtacaatgaatacattgtttataatgtggagcagattaggatgcgttatgttgttaacgttaaattcaatttt 39511583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 92
Target Start/End: Original strand, 39518295 - 39518363
Alignment:
Q  24 acaatgaatacattgtttataatgtggaccagattaagatgcgttatgttgttaacgttaaattcaatt 92  Q
    ||||||| |||||||||||||||||||| ||||||| ||||||||||||||| || |||||||||||||    
T  39518295 acaatgagtacattgtttataatgtggagcagattaggatgcgttatgttgtgaatgttaaattcaatt 39518363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University