View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14507_low_18 (Length: 298)

Name: NF14507_low_18
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14507_low_18
NF14507_low_18
[»] chr1 (1 HSPs)
chr1 (1-167)||(23880742-23880902)
[»] chr3 (1 HSPs)
chr3 (1-82)||(30999116-30999197)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 23880902 - 23880742
Alignment:
Q  1 tggtcacctgccaattacaagttttctaacagaaaattctttcacaagctctgtaacagtaacagattgatcagataaattggactgaagaattctggct 100  Q
    |||| ||||||||||||||||||||| ||||| ||||||||||||||| |||||||||       |||||||||||||||||||| ||||||||||||||    
T  23880902 tggttacctgccaattacaagttttccaacaggaaattctttcacaagatctgtaacaa------attgatcagataaattggacagaagaattctggct 23880809  T
Q  101 tcaatcttccgcgagagcataacgaaccatccttttggtgagacagttttaacataaccctgtccaa 167  Q
    ||||||||||| ||||||| || ||| |||||||||| |||||||||||||||||||||||||||||    
T  23880808 tcaatcttccgtgagagcagaatgaagcatccttttgatgagacagttttaacataaccctgtccaa 23880742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 30999197 - 30999116
Alignment:
Q  1 tggtcacctgccaattacaagttttctaacagaaaattctttcacaagctctgtaacagtaacagattgatcagataaattg 82  Q
    |||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
T  30999197 tggtcacctgccaattacaagttttccaacaggaaattctttcacaagatctgtaacagtaacagattgatcagataaattg 30999116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University