View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14475_high_35 (Length: 231)

Name: NF14475_high_35
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14475_high_35
NF14475_high_35
[»] chr7 (1 HSPs)
chr7 (94-231)||(28823602-28823740)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 94 - 231
Target Start/End: Original strand, 28823602 - 28823740
Alignment:
Q  94 caactcgctgcgccacgagaattgagaaactagtaattgctgggggagaactgaaaaacaacagatcacattgtattcctttgacaacttccaagcagat 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28823602 caactcgctgcgccacgagaattgagaaactagtaattgctgggggagaactgaaaaacaacagatcacattgtattcctttgacaacttccaagcagat 28823701  T
Q  194 tcaaaccctaatagacccgatgtgatgatg-tccatctc 231  Q
    ||||||||||||| ||||  |||| ||||| ||||||||    
T  28823702 tcaaaccctaataaacccactgtgctgatgctccatctc 28823740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University