View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14471_high_7 (Length: 258)

Name: NF14471_high_7
Description: NF14471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14471_high_7
NF14471_high_7
[»] chr3 (1 HSPs)
chr3 (19-248)||(41253367-41253595)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 41253595 - 41253367
Alignment:
Q  19 aggtcactttttattaatttatggagggggaaataaaacggaacaaatgcattcataaatgtggttgtgaatgtgaagtgggaacaccgttattgctaca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41253595 aggtcactttttattaatttatggagggggaaataaaacggaacaaatgcattcataaatgtggttgtgaatgtgaagtgggaacaccgttattgctaca 41253496  T
Q  119 agaccaaaaatggagaatgttctgcatgaaaaatcttactatacatttacccagccagtgacggcactggtataaatattcgacttatgtcctttgcata 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||    
T  41253495 agaccaaaaatggagaatgttctgcatgaaaaatcttactatacatttacccagcctgtgacggcactggtataaatattcgac-tatgtcctttgcata 41253397  T
Q  219 tgtttgccgtgagacctagacttacctttg 248  Q
    ||||||||||||||||||||||||||||||    
T  41253396 tgtttgccgtgagacctagacttacctttg 41253367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University