View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14464_low_47 (Length: 206)

Name: NF14464_low_47
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14464_low_47
NF14464_low_47
[»] chr3 (1 HSPs)
chr3 (95-198)||(47036851-47036954)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 95 - 198
Target Start/End: Complemental strand, 47036954 - 47036851
Alignment:
Q  95 atgaaaaagaatcaggagcacaattacagagtcatgtcggtattatatttatgataaatgcagttatgtttatcggttgtcatgtgaatgctctctgctc 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  47036954 atgaaaaagaatcaggagcacaattacagagtcatgtcggtattatatttatgataaatgcagttatgtttatcggttgtcatgtgaatgctctcttctc 47036855  T
Q  195 ctcc 198  Q
    ||||    
T  47036854 ctcc 47036851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University