View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14460_low_22 (Length: 257)

Name: NF14460_low_22
Description: NF14460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14460_low_22
NF14460_low_22
[»] chr4 (1 HSPs)
chr4 (4-243)||(27052614-27052853)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 27052853 - 27052614
Alignment:
Q  4 actacaatcacactttatgattctaannnnnnnatcaagcactttcttatagttattattattgagaaatttcatattaaccagtgtctatgatgccaat 103  Q
    |||||||| |||||||||||||||||       |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  27052853 actacaattacactttatgattctaatttttatatcaagcactttcttatagttattattattgagaaagttcatattaaccagtgtctatgatgccaat 27052754  T
Q  104 gatggtgcctcttccagattgagccttagaaagaacagcagttactatatcttgctttacatgcaagaaatcccaacttcttgttgtgtgaagagtaaga 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27052753 gatggtgcctcttccagattgagccttagaaagaacagcagttactatatcttgctttacatgcaagaaatcccaacttcttgttgtgtgaagagtaaga 27052654  T
Q  204 attttattcggaatcacacggacaacaccgggaaaatctg 243  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  27052653 attttattcggaatcacacggacaacaccgggaaaatctg 27052614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University