View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14435_low_65 (Length: 288)

Name: NF14435_low_65
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14435_low_65
NF14435_low_65
[»] chr5 (1 HSPs)
chr5 (1-178)||(13796886-13797063)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 13796886 - 13797063
Alignment:
Q  1 attctttaagattaggatttaaaagacaaatatcatagagactatgagaggatgactatcctcgttgctgtctaggtttttaccacgtttaaataatcaa 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||| ||    
T  13796886 attctttaagattaggatttaaaagacaaatatcataaagactatgagaggatgactattctaattgctgtctaggtttttaccacgtttaaataattaa 13796985  T
Q  101 acatatggggtaatgactgctcgtttgacttaacggaatagttcaacacatcatggtttattcaaaaaacaatatccc 178  Q
    |||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  13796986 acatatggggcaatgaccgctcgtttgacttaatggaatagttcaacacatcatggtttattcaaaaaacaatatccc 13797063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University