View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14433_high_14 (Length: 325)

Name: NF14433_high_14
Description: NF14433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14433_high_14
NF14433_high_14
[»] chr7 (1 HSPs)
chr7 (18-320)||(42341402-42341707)


Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 18 - 320
Target Start/End: Original strand, 42341402 - 42341707
Alignment:
Q  18 agcagcagtgtcatctcaccggccgcag---cagcattacgctgcagtgtatccgaacaacaactctacaatggttcaggctgcttcatttgctattggc 114  Q
    ||||||||||||||||||||||||||||   ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  42341402 agcagcagtgtcatctcaccggccgcagcagcagcattacgccgcagtgtatccgaacaacaactctacaatggctcaggctgcttcatttgctattggc 42341501  T
Q  115 ggcggcgggaatctaaacgttgttgcgccaccgtaccaaacggtggcacagggaggtggagcagttggagaaccttcgagttcagggtatgttgggaatg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42341502 ggcggcgggaatctaaacgttgttgcgccaccgtaccaaacggtggcacagggaggtggagcagttggagaaccttcgagttcagggtatgttgggaatg 42341601  T
Q  215 gtaagacgagagatagtataggtacggggtatcctccaccgccgccagctgtttgttacggagggagagtggtgaatggagcagcgggcggttatggcat 314  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |    
T  42341602 gtaagacgagagatagtataggtacggggtatcctccgccgccgccagctatttgttacggagggagagtggtgaatggagcagcgggcggttatggcgt 42341701  T
Q  315 ggcagt 320  Q
    ||||||    
T  42341702 ggcagt 42341707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University