View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14425_low_12 (Length: 238)

Name: NF14425_low_12
Description: NF14425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14425_low_12
NF14425_low_12
[»] chr8 (1 HSPs)
chr8 (77-220)||(39563332-39563475)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 77 - 220
Target Start/End: Complemental strand, 39563475 - 39563332
Alignment:
Q  77 cccattaaagaaatattctaacagagttcattctagtgaaattgaatagatgggacataaaatttctccaatagatcaaataagacaacataacgcttct 176  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39563475 cccattaaagaaatattctaacagagttcattctagtgaaactgaatagatgggacataaaatttctccaatagatcaaataagacaacataacgcttct 39563376  T
Q  177 tttggctttgattgaatagacctgtcactgcttgtgtccccctt 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  39563375 tttggctttgattgaatagacctgtcactgcttgtgtccccctt 39563332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University