View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441_low_107 (Length: 247)

Name: NF1441_low_107
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441_low_107
NF1441_low_107
[»] chr3 (2 HSPs)
chr3 (175-229)||(6043274-6043328)
chr3 (16-66)||(6043436-6043486)


Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 6043328 - 6043274
Alignment:
Q  175 ctccttcaaaatatcgtgctttattttatttggggtcctttcctatgtacttcat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6043328 ctccttcaaaatatcgtgctttattttatttggggtcctttcctatgtacttcat 6043274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 6043486 - 6043436
Alignment:
Q  16 atgaagaaaataagagagaaatataatttaatgtcttcttgctacatggag 66  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  6043486 atgaagaaaataagagagaaatataattgaatgtcttcttgctacatggag 6043436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University