View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441_high_84 (Length: 263)

Name: NF1441_high_84
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441_high_84
NF1441_high_84
[»] chr3 (1 HSPs)
chr3 (105-257)||(53033795-53033947)
[»] chr1 (1 HSPs)
chr1 (105-194)||(7885425-7885514)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 105 - 257
Target Start/End: Complemental strand, 53033947 - 53033795
Alignment:
Q  105 tacctcaagtttgcacatgaggtcttgggcagtgtgggcagatacaataatgtgacgggcagctggtgttacaaaaccttcatccacagctttgtccatg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53033947 tacctcaagtttgcacatgaggtcttgggcagtgtgggcagatacaataatgtgacgggcagctggtgttacaaaaccttcatccacagctttgtccatg 53033848  T
Q  205 aatgccagtagtgaattgtagtaaccatccacgttcaacagccccacctatgc 257  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53033847 aatgccagtagtgaattgtagtaaccatccacgttcaacagccccacctatgc 53033795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 105 - 194
Target Start/End: Complemental strand, 7885514 - 7885425
Alignment:
Q  105 tacctcaagtttgcacatgaggtcttgggcagtgtgggcagatacaataatgtgacgggcagctggtgttacaaaaccttcatccacagc 194  Q
    ||||||||| |||||||||||||| || ||||| || ||||| |||||||| ||||| |||||  ||||||  ||||||||||| |||||    
T  7885514 tacctcaagcttgcacatgaggtcctgagcagtatgtgcagacacaataatatgacgagcagcctgtgttatgaaaccttcatctacagc 7885425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University