View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14419_low_26 (Length: 239)

Name: NF14419_low_26
Description: NF14419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14419_low_26
NF14419_low_26
[»] chr4 (2 HSPs)
chr4 (1-156)||(11592281-11592436)
chr4 (1-156)||(11645683-11645838)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 11592436 - 11592281
Alignment:
Q  1 tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaaacttggaaccttttggcttctcttttgac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  11592436 tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaatcttggaaccttttggcttctcttttgac 11592337  T
Q  101 tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11592336 tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct 11592281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 11645683 - 11645838
Alignment:
Q  1 tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaaacttggaaccttttggcttctcttttgac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  11645683 tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaatcttggaaccttttggcttctcttttgac 11645782  T
Q  101 tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11645783 tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct 11645838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University