View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14419_low_17 (Length: 361)

Name: NF14419_low_17
Description: NF14419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14419_low_17
NF14419_low_17
[»] chr4 (2 HSPs)
chr4 (158-345)||(2280244-2280430)
chr4 (53-93)||(2280492-2280532)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 158 - 345
Target Start/End: Complemental strand, 2280430 - 2280244
Alignment:
Q  158 catagtcgaaaccatagttgtcttcttgaaattaatcagtaatccccaacaacgacgccaaaaacttgatatttgatgtcgcaagtgtactatactctta 257  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  2280430 catagtcgaaaccatagttgtcttgttgaaattaatcagtaatccccaacaacgacgccaaaaacttgatgtttgatgtcgcaagtgtactatactctta 2280331  T
Q  258 tcaagtaaaaataacaatacannnnnnnnnnnaagagaataacaatacatttgttttcacatggattgtgaaatttatacttaacaat 345  Q
    |||||||||||||| ||||||           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2280330 tcaagtaaaaataataataca-ttttttttttaagagaataacaatacatttgttttcacatggattgtgaaatttatacttaacaat 2280244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 2280532 - 2280492
Alignment:
Q  53 aaaagcaataagaacttgctccttttttgtcttcagatttt 93  Q
    |||||||||||||| ||||||||||||||||||||||||||    
T  2280532 aaaagcaataagaatttgctccttttttgtcttcagatttt 2280492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University