View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14406_high_20 (Length: 308)

Name: NF14406_high_20
Description: NF14406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14406_high_20
NF14406_high_20
[»] scaffold0064 (2 HSPs)
scaffold0064 (14-286)||(21669-21941)
scaffold0064 (10-291)||(4454-4735)
[»] scaffold0116 (1 HSPs)
scaffold0116 (14-289)||(10658-10933)


Alignment Details
Target: scaffold0064 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: scaffold0064
Description:

Target: scaffold0064; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 14 - 286
Target Start/End: Original strand, 21669 - 21941
Alignment:
Q  14 aggctagcaatcagttcccaaattaaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggagcggg 113  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21669 aggctagcaatcagttcccaaattgaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggagcggg 21768  T
Q  114 agatatgtagaagccaggaaacgtcgttgatggagttttcaagttgggaggatgttttgcgtaaagcatcaattgagatgatggtgaagatgcgcttctt 213  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  21769 agatatgtagaagccaggaaacatcgttgatggagttttcaagttgggaagatgttttgcggaaagcatcaattgagatgatggtgaagatgcgcttctt 21868  T
Q  214 gatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatc 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21869 gatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatc 21941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0064; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 10 - 291
Target Start/End: Original strand, 4454 - 4735
Alignment:
Q  10 acataggctagcaatcagttcccaaattaaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggag 109  Q
    ||||||||| ||||| ||||||||||||||||  |  ||||| || || |||  |||||||||||||||| |||| ||||| ||||||| ||||| | ||    
T  4454 acataggctggcaataagttcccaaattaaggtaaccatggggtcatttaaaattatggaaggaaggatgtgattttcactatcatgatcttcattgcag 4553  T
Q  110 cgggagatatgtagaagccaggaaacgtcgttgatggagttttcaagttgggaggatgttttgcgtaaagcatcaattgagatgatggtgaagatgcgct 209  Q
    |||||||||| ||  ||||| ||||| | |   |||| ||||||||||||||||||||||  | | ||||   |  | | ||||||| ||||||  ||||    
T  4554 cgggagatatataatagccaagaaacattgcctatggtgttttcaagttgggaggatgttcggtggaaagtggctttggggatgatgttgaagacacgct 4653  T
Q  210 tcttgatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatcggctg 291  Q
    || ||||| ||| ||  ||||| ||||||| ||| |||||||| | |||||||| ||||||||||| || ||||||| ||||    
T  4654 tcctgatggtgtctgtacggcatttgaggaccaacgaaagggtcttattgagtacatgttcggttttcttgaggatctgctg 4735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 14 - 289
Target Start/End: Original strand, 10658 - 10933
Alignment:
Q  14 aggctagcaatcagttcccaaattaaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggagcggg 113  Q
    |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | ||| ||| ||||| | ||||||||||||||||    
T  10658 aggctagcaatcagctcccaaattaaggcgaggatgggctcattgaaagctatggaaggaaggataaaattttcattgtcaagcttttcatcggagcggg 10757  T
Q  114 agatatgtagaagccaggaaacgtcgttgatggagttttcaagttgggaggatgttttgcgtaaagcatcaattgagatgatggtgaagatgcgcttctt 213  Q
    |||||||||| ||||||  ||||| ||| ||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||| |||||   ||||||    
T  10758 agatatgtaggagccagtgaacgttgtttatggagttttcaagttgggtggatgttttgcggaaagcatcaatggagatgatggtaaagatcaacttctt 10857  T
Q  214 gatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatcggc 289  Q
    |||||  |||||| || |||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
T  10858 gatgtgatttgggtggaacttaaggatcaacgaaagggtctcattgagtatatgttcggtttgctcgaggatcggc 10933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University