View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14404_low_82 (Length: 215)

Name: NF14404_low_82
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14404_low_82
NF14404_low_82
[»] chr4 (1 HSPs)
chr4 (71-196)||(48823428-48823552)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 71 - 196
Target Start/End: Complemental strand, 48823552 - 48823428
Alignment:
Q  71 gttagggaaagaacaactgaaatattatcacgccatatcggcttacataaaaataattttgaaatacagctgtttttcttttgacnnnnnnntacagttg 170  Q
    ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||       ||||||||    
T  48823552 gttagggaaagaacaactgaaatattatcacgccatatcagctaacataaaaataattttgaaatacagctgtttttcttttgac-aaaaaatacagttg 48823454  T
Q  171 ttctgatgcaaaaagcaatactgttc 196  Q
    ||||||||||||||||||||||||||    
T  48823453 ttctgatgcaaaaagcaatactgttc 48823428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University