View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1437_low_14 (Length: 240)

Name: NF1437_low_14
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1437_low_14
NF1437_low_14
[»] chr7 (1 HSPs)
chr7 (92-238)||(6055428-6055575)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 92 - 238
Target Start/End: Complemental strand, 6055575 - 6055428
Alignment:
Q  92 gagataatttgatctcaatcaatagtatttaaaaagatatcatttaacccgtataatagaaaaa-ctactttatctttctcaatgatcaaatttagtaat 190  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||    
T  6055575 gagataatttggtctcaagcaatagtatttaaaaagatatcatttaacccgtataatagaaaaaactactttatttttctcaatgatcaaatttagtaat 6055476  T
Q  191 atagcttttttaataactaaaataagttttcactctttattatctttt 238  Q
    ||||||  ||||||||||||||| ||||||||||||||||||||||||    
T  6055475 atagctcatttaataactaaaatgagttttcactctttattatctttt 6055428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University