View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14376_high_38 (Length: 335)

Name: NF14376_high_38
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14376_high_38
NF14376_high_38
[»] chr3 (3 HSPs)
chr3 (160-255)||(39980004-39980102)
chr3 (20-96)||(39979864-39979940)
chr3 (255-320)||(39980081-39980146)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 160 - 255
Target Start/End: Original strand, 39980004 - 39980102
Alignment:
Q  160 ggcagaccgtgtgttactcactccttcactctctt---caccaaccacaatggctactatcaccggcggcgccgccgcacgcatgattccctccgccac 255  Q
    |||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39980004 ggcagaccgtgtgttactcactccttcactctcttcttcaccaaccacaatggctactatcaccggcggcgccgccgcacgcatgattccctccgccac 39980102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 39979864 - 39979940
Alignment:
Q  20 gtggattatttcacaaacacaaaaagtagagttttgattggcaaatccaggattaccatccaaaacacaaggagaag 96  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39979864 gtggattatttcacaaacacaaaaagtagagttttgattggcaaatccaggattaccatccaaaacacaaggagaag 39979940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 255 - 320
Target Start/End: Original strand, 39980081 - 39980146
Alignment:
Q  255 cacgcatgattccctccgccactagagccaccgtctcactttcaacttcccgttcgttcttctcat 320  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39980081 cacgcatgattccctccgccactagagccaccgtctcactttcaacttcccgttcgttcttctcat 39980146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University