View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14371_low_7 (Length: 394)

Name: NF14371_low_7
Description: NF14371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14371_low_7
NF14371_low_7
[»] chr2 (2 HSPs)
chr2 (1-257)||(4759684-4759940)
chr2 (267-371)||(4759554-4759655)
[»] chr4 (2 HSPs)
chr4 (44-173)||(26982154-26982283)
chr4 (44-96)||(26999135-26999187)


Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 4759940 - 4759684
Alignment:
Q  1 ggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4759940 ggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagatt 4759841  T
Q  101 gaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtcgcaggtggttagtc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4759840 gaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtcacaggtggttagtc 4759741  T
Q  201 accggagagcagggttaacggcgttgatttacctagctgatggaacttacatgtaag 257  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||    
T  4759740 accggagagcagggttgacggcgttgatttacctagctgatggaacttacacgtaag 4759684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 267 - 371
Target Start/End: Complemental strand, 4759655 - 4759554
Alignment:
Q  267 atcaagcagcctaacagcgaatttcacgcaccaccaggttcaaactcatgtcacaatatatgaaatgtctctagannnnnnnncttcatgtcttattagt 366  Q
    |||||||||||||||||||||||||||||||||   ||||||||||| | |||||||||||||||||||||||||        |||||||||||||||||    
T  4759655 atcaagcagcctaacagcgaatttcacgcacca---ggttcaaactcgtctcacaatatatgaaatgtctctagattttttttcttcatgtcttattagt 4759559  T
Q  367 ttttt 371  Q
    |||||    
T  4759558 ttttt 4759554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 44 - 173
Target Start/End: Complemental strand, 26982283 - 26982154
Alignment:
Q  44 gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataa 143  Q
    ||||||| |||||||||||| |||||||||||||| |||  ||| |||||||| ||||| |   | | |||| ||||||||||||| ||||||||||| |    
T  26982283 gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaagatattgagatgctggctaaacaagatgttaaggtcagaaagttgatga 26982184  T
Q  144 cagaacttggagtggtgccggttttggtat 173  Q
    | |||||| | |||||||| || |||||||    
T  26982183 ctgaacttcgggtggtgcctgtattggtat 26982154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 44 - 96
Target Start/End: Original strand, 26999135 - 26999187
Alignment:
Q  44 gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaaga 96  Q
    ||||||| |||||||||||| |||||||||||||| |||  ||| ||||||||    
T  26999135 gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaaga 26999187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University