View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14371_low_14 (Length: 242)

Name: NF14371_low_14
Description: NF14371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14371_low_14
NF14371_low_14
[»] chr8 (1 HSPs)
chr8 (1-242)||(7864163-7864404)


Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 7864404 - 7864163
Alignment:
Q  1 aaagaatgcacaacatcgacaaaagtcacaaactttggtnnnnnnnnntttggtttgaatcttaccaatattcttttgcaggctggtgatagaggtacaa 100  Q
    ||||||||||||||||||||||||||||||||| |||||         |||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  7864404 aaagaatgcacaacatcgacaaaagtcacaaaccttggtaaaaacaaatttggtttgaatcttaccaatattcttttgcaggttggtgatagaggtacaa 7864305  T
Q  101 aactttcaggaggtcaaaagcaaagaattgcattggctagagcaatgataaaaaatcctaaaatccttcttttagatgaacctaccagtgctcttgatgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7864304 aactttcaggaggtcaaaagcaaagaattgcattggctagagcaatgataaaaaatcctaaaatccttcttttagatgaacctaccagtgctcttgatgc 7864205  T
Q  201 cgagtcagaagctgcagttcaaagggccattgacaagatttc 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  7864204 cgagtcagaagctgcagttcaaagggccattgacaagatttc 7864163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University