View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14356_low_51 (Length: 214)

Name: NF14356_low_51
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14356_low_51
NF14356_low_51
[»] chr7 (1 HSPs)
chr7 (13-137)||(7321041-7321165)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 7321165 - 7321041
Alignment:
Q  13 attatactttggtgattaatatttgaatcttaaaccatatgagtgtggtgtctcctaatctccatccaaaggtgcaggtgcaatcttggtgctactttgg 112  Q
    |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7321165 attatactttagtgattactatttgaatcttaaaccatatgagtgtggtgtctcctaatctccatccaaaggtgcaggtgcaatcttggtgctactttgg 7321066  T
Q  113 attatataaagaataccacaaccag 137  Q
    |||||||||||||||||||||||||    
T  7321065 attatataaagaataccacaaccag 7321041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University