View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14356_high_33 (Length: 258)

Name: NF14356_high_33
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14356_high_33
NF14356_high_33
[»] chr2 (1 HSPs)
chr2 (124-242)||(34101668-34101786)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 124 - 242
Target Start/End: Complemental strand, 34101786 - 34101668
Alignment:
Q  124 cctctgctaagtaaaccttcgttatatttctgcaacatatcatcaatttcttccacatatgtttctttcggcggtggcaaaacagaattagccgtagaat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34101786 cctctgctaagtaaaccttcgttatatttctgcaacatatcatcaatttcttccacatatgtttctttcggcggtggcaaaacagaattagccgtagaat 34101687  T
Q  224 tttcagcgaatcttccaac 242  Q
    |||||||||||||||||||    
T  34101686 tttcagcgaatcttccaac 34101668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University