View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14352_high_31 (Length: 211)

Name: NF14352_high_31
Description: NF14352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14352_high_31
NF14352_high_31
[»] chr4 (1 HSPs)
chr4 (21-201)||(35743970-35744150)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 35743970 - 35744150
Alignment:
Q  21 tgaatggtgcaggtaggggaggagggggtgggggagaagatgaagaaatagacattgatgcttgttgcagatgagaaggtgtttgtgttggtttaggaga 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  35743970 tgaatggtgcaggtaggggaggagggggtgggggagaagatgaagaaatagacattgatgcttgttgtagatgagaaggtgtttgtgttggtttaggaga 35744069  T
Q  121 atttggttgaaattgtttaggagatagtggtaactccacttcttccataacttgatcatgtttaaccattttttgatgatg 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35744070 atttggttgaaattgtttaggagatagtggtaactccacttcttccataacttgatcatgtttaaccattttttgatgatg 35744150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University