View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14349_low_124 (Length: 219)

Name: NF14349_low_124
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14349_low_124
NF14349_low_124
[»] chr4 (1 HSPs)
chr4 (68-219)||(21725211-21725361)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 68 - 219
Target Start/End: Original strand, 21725211 - 21725361
Alignment:
Q  68 ttagtttccactacggtgggacaactactttgattactcaacataattcgactacaacaaaccaaaataagcacatgaatggctnnnnnnncatcaggga 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||       |||||||||    
T  21725211 ttagtttccactacggtgggacaactactttgattactcaacataattcgactacaacaaaccaaaataagcacaagaatggct-aaaaaacatcaggga 21725309  T
Q  168 aggaacaagtttgttacattaaactgatatgaaacatacaagttaatgagac 219  Q
    ||||||| |||||||||||| ||||| |||||||||||||||||||||||||    
T  21725310 aggaacacgtttgttacattgaactgctatgaaacatacaagttaatgagac 21725361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University