View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14340_high_22 (Length: 288)

Name: NF14340_high_22
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14340_high_22
NF14340_high_22
[»] chr3 (2 HSPs)
chr3 (196-268)||(34381095-34381167)
chr3 (19-82)||(34381275-34381338)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 196 - 268
Target Start/End: Complemental strand, 34381167 - 34381095
Alignment:
Q  196 tattcgttgctcaagaaggcgacacactcaccacttctctagaggaagaagctggattgagtctcgattggga 268  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  34381167 tattcgttgctcaagaaggcgacacactcaccacttctctagacgaagaagctggattgagtctcgattggga 34381095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 34381338 - 34381275
Alignment:
Q  19 tgtctatcacttccaacactccactcttcaaatccctaaccatggccgaatcctgcctcctctc 82  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  34381338 tgtctatcacttccaccactccactcttcaaatccctaaccatggccgaatcctgcctcctctc 34381275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University