View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14335_low_36 (Length: 259)

Name: NF14335_low_36
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14335_low_36
NF14335_low_36
[»] chr3 (1 HSPs)
chr3 (99-247)||(34749126-34749268)


Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 99 - 247
Target Start/End: Complemental strand, 34749268 - 34749126
Alignment:
Q  99 gtccacaacaattaatgtaattgtactatgtctatatagttgcttgaggttgttccccaatttttgtttacatcaatccatcaatcaaagtcattgcaac 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
T  34749268 gtccacaacaattaatgtaattgtactatgtctatatagttgcttgaggttgttcccc-atttatgtttacatcaatccatcaatcaaagtcattgcaac 34749170  T
Q  199 tttgcagggtttggtacccaaccctatgcttaacaaaatttaacagaat 247  Q
    |||||||||||||||     |||||||||||||||||||||||||||||    
T  34749169 tttgcagggtttggt-----accctatgcttaacaaaatttaacagaat 34749126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University