View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14334_high_25 (Length: 246)

Name: NF14334_high_25
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14334_high_25
NF14334_high_25
[»] chr5 (2 HSPs)
chr5 (64-231)||(12037687-12037851)
chr5 (63-142)||(11858975-11859054)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 12037851 - 12037687
Alignment:
Q  64 ccaacagctacatgctcagtacttttctcaaaatcttcacatgcagactttcttttctcagtagtattactaataactgctgctgcttcttcttctccta 163  Q
    ||||||||||||||||  ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||    
T  12037851 ccaacagctacatgcttggtatttttctcaaagtcttcacatgcagactttcttttctcagtagtattactaataactgctgct---tcttcttctccta 12037755  T
Q  164 gcttcatctcttgctcgatcaggcgtttgagttcctcggtgattttcttaacatgacgagtgcctttg 231  Q
    ||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||    
T  12037754 gcttcgtctcttgctcgatcaggcgtttgagtttctcggtggttttcttaacatgacgagtgcctttg 12037687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 142
Target Start/End: Complemental strand, 11859054 - 11858975
Alignment:
Q  63 gccaacagctacatgctcagtacttttctcaaaatcttcacatgcagactttcttttctcagtagtattactaataactg 142  Q
    ||||||||||||||||||||||||||||||||||||||   ||||  |||||||||||||| ||||||||||||||||||    
T  11859054 gccaacagctacatgctcagtacttttctcaaaatctttgtatgccaactttcttttctcattagtattactaataactg 11858975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University