View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14323_low_56 (Length: 236)

Name: NF14323_low_56
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14323_low_56
NF14323_low_56
[»] chr1 (2 HSPs)
chr1 (1-153)||(12104128-12104280)
chr1 (193-221)||(12104083-12104111)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 12104280 - 12104128
Alignment:
Q  1 tacctcatttagtttcactgacaccacttgtactaagtacttaattcttaaaaacaaaaatgaatgcctttcaagaaacaagtaaacataaacaggttgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  12104280 tacctcatttagtttcactgacaccacttgtactaagtacttaattcttaaaaacaaaaatgaatgcctttcaagaaacaagtaaacctaaacaggttgc 12104181  T
Q  101 taattacatttactggtatgaaatgaagttgtcaaatatagtactcattagta 153  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12104180 taattacatttactggtatgaaatgaagttgtcaaatatagtactcattagta 12104128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 221
Target Start/End: Complemental strand, 12104111 - 12104083
Alignment:
Q  193 atctattataaacatattagtgaaaaagt 221  Q
    |||||||||||||||||||||||||||||    
T  12104111 atctattataaacatattagtgaaaaagt 12104083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University