View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1431_high_22 (Length: 201)

Name: NF1431_high_22
Description: NF1431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1431_high_22
NF1431_high_22
[»] scaffold0002 (1 HSPs)
scaffold0002 (15-189)||(333516-333690)
[»] chr1 (1 HSPs)
chr1 (31-116)||(42168930-42169015)


Alignment Details
Target: scaffold0002 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 333516 - 333690
Alignment:
Q  15 ctgtgttcgagtaaacatgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  333516 ctgtgttcgagtaaacatgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctc 333615  T
Q  115 aaagatgttttacaaagggaagttggcatcgactttgttgaaaaacttgcaaaaattcgaatccttgcacaggtt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  333616 aaagatgttttacaaagggaagttggcatcgactttgttgaaaaacttgcaaaaattcgaatccttgcacaggtt 333690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 42168930 - 42169015
Alignment:
Q  31 atgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctcaa 116  Q
    ||||| |||||||| ||||| ||||| || ||||| || |||||  |||| || ||||| |||| ||||||||| |||||||||||    
T  42168930 atgacagacactacagatgatattgctgaagaaatctcgttccagagctttgatgatgattgtaggttgcttggtaatcttctcaa 42169015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University