View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14318_low_26 (Length: 236)

Name: NF14318_low_26
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14318_low_26
NF14318_low_26
[»] chr8 (1 HSPs)
chr8 (23-166)||(27661450-27661594)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 23 - 166
Target Start/End: Original strand, 27661450 - 27661594
Alignment:
Q  23 tcctttaa-ctcttaactcaaccaaagaactacacattatcatcttaaaaagtaaattgtttcttcctttctaagcatttatgagcaattcttgtcagct 121  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  27661450 tcctttaatctcttaactcaaccaaagaactacacattatcatcttaaaaagtaaattgtttcttcctttctaagcatttatgagcaattcttgtcggct 27661549  T
Q  122 aaaactacaagtgaaggggttggtacaatactatggtcatactca 166  Q
    |||||||||||||||||||| ||||||||||||||||||||||||    
T  27661550 aaaactacaagtgaaggggtgggtacaatactatggtcatactca 27661594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University