View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14318_high_11 (Length: 311)

Name: NF14318_high_11
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14318_high_11
NF14318_high_11
[»] chr7 (1 HSPs)
chr7 (1-300)||(49040106-49040401)
[»] chr4 (3 HSPs)
chr4 (81-122)||(19671772-19671813)
chr4 (81-122)||(19742892-19742933)
chr4 (81-122)||(19797155-19797196)


Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 49040106 - 49040401
Alignment:
Q  1 tcagtgttggatgctatgcagtattatctagaactaagtgagtggcatatggagccatctcgttccacattacaccgctttggtaacacttcaagtagtt 100  Q
    ||||||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||    
T  49040106 tcagtgttggatgctatgcagaataatatagaactaagtgagtggcatatggagccatcttgttccacattacatcgctttggtaacacttcaagtagtt 49040205  T
Q  101 cactttggtatgagttagcatacgtagaggccaagggtagagtttcaaagggggatagggtgtggcagattgattgcatttggggctggttttaaatgta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||| |||||||||||||    
T  49040206 cactttggtatgagttagcatacgtagaggccaagggtagagtttcaaagggggatagggtgtggca----gattgcatttggggcaggttttaaatgta 49040301  T
Q  201 acagtgccgtatggagggcatgtcgtgacataccacttctacatgactggacgggaaatccatgggatgactctgttaacaactaccctattcatctctc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  49040302 acagtgccgtatggagggcatgtcgtgacataccacttctacatgactggacgggaaatccatgggatgactctgttaacaactaccctattcatttctc 49040401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 19671813 - 19671772
Alignment:
Q  81 tggtaacacttcaagtagttcactttggtatgagttagcata 122  Q
    |||||||||||||||||||||  ||||||||||||| |||||    
T  19671813 tggtaacacttcaagtagttctgtttggtatgagttggcata 19671772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 19742933 - 19742892
Alignment:
Q  81 tggtaacacttcaagtagttcactttggtatgagttagcata 122  Q
    |||||||||||||||||||||  ||||||||||||| |||||    
T  19742933 tggtaacacttcaagtagttctgtttggtatgagttggcata 19742892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 19797155 - 19797196
Alignment:
Q  81 tggtaacacttcaagtagttcactttggtatgagttagcata 122  Q
    |||||||||||||||||||||  ||||||||||||| |||||    
T  19797155 tggtaacacttcaagtagttctgtttggtatgagttggcata 19797196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University